Gene Bridges 
 

Home | Company | Distributors | Contact

Back Back to list

Quick & Easy E.coli Gene Deletion Kit

For fast knockouts or modifications of genes on the E.coli chromosome.

Manual [PDF]      Contact Support      Order      Sequences

Features

  • Faithful recombineering by Red/ET
  • Fast and precise
  • Multiple knockouts possible
  • Convenient removal of the recombineering plasmid

Applications

  • This kit is designed to knockout or alter genes on the E.coli chromosome in less than one week

Targeted disruption of genes on the E.coli chromosome

1. Transformation
The E.coli strain which will be modified is transformed with the expression plasmid pRedET.

2. Red/ET Recombination
Red/ET expression is induced by addition of L-arabinose and a temperature shift. The FRT-PGK-gb2-neo-FRT cassette containing 50 bp homology arms is transformed. Red/ET mediated recombination disrupts the target locus by inserting the cassette.

3. Optional: Removal of selection marker
Flp-mediated excision to leave a single FRT site behind. (See also our FRT selection cassettes and Flp expression plasmids & strains).

Description

Red/ET recombination allows the exchange of genetic information in a base pair precise, specific, and faithful manner. An FRT-flanked kanamycin resistance marker cassette is supplied with the kit which can be used to replace a gene on the E.coli chromosome. Red/ET recombination can replace fragments as large as 30kb from the E.coli chromosome.

The use of a FRT-flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP-recombinase step, if required. FLP expression plasmids can be purchased from Gene Bridges.

Multiple knockouts can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges.

The recombination process is strictly controlled due to an optimized design of the pRedET expression plasmid. The genes for the Recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for a convenient removal of the plasmid after recombination.

Contents

  • Two Red/ET Recombination protein expression plasmids pRedET (tet) and pRedET (amp). Any E.coli strain can be made Red/ET proficient by transformation with these plasmids.
  • FRT flanked kanamycin resistance template (FRT-PGK-gb2-neo-FRT) to be used for your own experiments.
  • Positive controls to replace the gene for mannose transporter (manX) on the E.coli chromosome.
  • Detailed protocols, descriptions of plasmids, maps and sequences.

Sequences

FRT-PGK-gb2-neo-FRT

FRT
Promoter
neoR
Terminator
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTA



Red/ET Training Courses

Next course: date to be announced
Details

Download Red/ET Brochure

Red/ET Brochure Gene Bridges' Red/ET Recombination brochure provides a comprehensive introduction to the technology and an overview on Red/ET related products and services.

Japanese Version

Publications

References

 

 

 

Terms & Conditions | Disclaimer | Top of Page
© 2014 Gene Bridges GmbH