Gene Bridges 
 

Home | Company | Distributors | Contact

Back Back to list

Counter Selection BAC Modification Kit

For advanced BAC modifications using a counter-selection cassette, also for bacterial chromosomes.

Manual [PDF]      Contact Support      Order      Sequences

Features

  • Fast BAC modification (2-3 weeks)
  • High Red/ET Recombination efficiency
  • Convenient removal of the Red/ET plasmid
  • Efficiency much higher as with the pSacB-neo system

Applications

  • Fragment exchange
  • Marker insertion and deletion without leaving a selection marker or any unwanted sequences
  • Introduction of short sequences e.g. point mutations, loxP sites, restriction sites, etc.
  • Can also be used for bacterial chromosome modifications and common ColE1 origin plasmids

Overview of two-step Exchange of a Non-Selectable Gene

1. Transformation of BAC host with Red/ET
In a first step the Red/ET plasmid pSC101-BAD-gbaA is transferred into the E.coli host that contains the BAC.

2. First Red/ET step
The expression of genes mediating Red/ET is induced by adding L-arabinose and a temperature shift from 30°C to 37°C. After induction, the cells are prepared for electroporation and the PCR product (rpsL-neo PCR product counter-selection/selection cassette) with the added homology arms is electroporated.

3. Selection & Extraction of the modified BAC DNA
Selection for colonies carrying the modified BAC. Only colonies carrying successfully modified BACs will survive kanamycin selection on the agar plates. A subsequent DNA mini preparation is used to confirm the successful integration of the counter-selection/ selection cassette.

4. Second Red/ET step
The expression of genes mediating Red/ET is induced by adding L-arabinose and a temperature shift from 30°C to 37°C. After induction, the cells are prepared for electroporation. The non-selectable DNA, which can be either just an oligonucleotide harboring the right and the left homology arms of the selection cassette and a point mutation (control reaction) or a gene flanked by homology arms, will be electroporated. The rpsL-neo counter-selection/selection cassette will be replaced by the non-selectable DNA.

5. Selection for the absence of the counter-selection/selection cassette
Only colonies in which the selection/counter-selection cassette was replaced by the non- selectable DNA fragment will grow on streptomycin containing plates. A subsequent DNA mini preparation is used to confirm the successful integration of the counter-selection/ selection cassette.

Description

This is a new version of counter-selection cassette pRpsL-neo based on Streptomycin selection. The kit is designed to modify any type of bacterial artificial chromosomes (BACs) within 2-3 weeks by using a counter-selection cassette. The included counter-selection cassette pRpsL-neo is based on Streptomycin selection which shows a much higher efficiency than pSacB-neo or comparable systems. This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids. This Kit combines the high Red/ET efficiency plus convenient removal of the Red/ET Recombination protein expression plasmid pRedET after recombination.

Contents

  • Red/ET Recombineering protein expression plasmid pRedET. Any E.coli strain can be made Red/ET proficient by transformation with this plasmid
  • BAC host E.coli strain DH10B already carrying the Red/ET plasmid
  • pRpsL-neomycin template to be used for your own experiments
  • Positive controls to introduce a point-mutation in a 150 kb BAC
  • Detailed protocols, descriptions of plasmids, maps and sequences

Sequences

rpsL-kanR/neoR selection cassette

Promoter
rpsL
KanR/NeoR
GGCCTGGTGATGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCG CCCTAAAATTCGGCGTCCTCATATTGTGTGAGGACGTTTTATTACGTGTTTACGA AGCAAAAGCTAAAACCAGGAGCTATTTAATGGCAACAGTTAACCAGCTGGTACGC AAACCACGTGCTCGCAAAGTTGCGAAAAGCAACGTGCCTGCGCTGGAAGCATGCC CGCAAAAACGTGGCGTATGTACTCGTGTATATACTACCACTCCTAAAAAACCGAA CTCCGCGCTGCGTAAAGTATGCCGTGTTCGTCTGACTAACGGTTTCGAAGTGACT TCCTACATCGGTGGTGAAGGTCACAACCTGCAGGAGCACTCCGTGATCCTGATCC GTGGCGGTCGTGTTAAAGACCTCCCGGGTGTTCGTTACCACACCGTACGTGGTGC GCTTGACTGCTCCGGCGTTAAAGACCGTAAGCAGGCTCGTTCCAAGTATGGCGTG AAGCGTCCTAAGGCTTAAGGAGGACAATCATGATTGAACAAGATGGATTGCACGC AGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAG ACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGG TTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGC AGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGG ATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGC AATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCG AAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGG ATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCT CAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGC TTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC GGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGC TGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCC GCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA



Red/ET Training Courses

Next course: date to be announced
Details

Download Red/ET Brochure

Red/ET Brochure Gene Bridges' Red/ET Recombination brochure provides a comprehensive introduction to the technology and an overview on Red/ET related products and services.

Japanese Version

Publications

References

 

 

 

Terms & Conditions | Disclaimer | Top of Page
© 2014 Gene Bridges GmbH