Gene Bridges 
 

Home | Company | Distributors | Contact

Back Back to list

BAC Subcloning Kit

For subcloning of DNA fragments from BACs and cosmids.

Manual [PDF]      Contact Support      Order      Sequences

Features

  • No restriction sites necessary
  • Fragments up to 20 kb can be subcloned
  • High Red/ET efficiency
  • Convenient removal of the Red/ET Recombination protein expression plasmid pRedET after recombination.

Overview of the strategy to subclone a gene from a BAC

1. PCR & Transformation
A linear minimal vector with flanking homology arms is constructed in a PCR reaction. After transformation of the E.coli BAC host with the Red/ET expression plasmid, the expression of the genes necessary for recombination is induced.

2. Recombination
In the next step, the linear vector (PCR product with the added homology arms) is electroporated into the cells. Red/ET mediated recombination takes place.

3. Selection
Clones carrying the subcloned fragment are identified by selection for ampicillin resistance.

Description

Contents

  • Red/ET Recombination protein expression plasmid pRedET. Any E. coli strain can be made Red/ET proficient by transformation with this plasmid
  • Linear vector carrying a ColE1 origin of replication plus ampicillin resistance gene to be used for the subcloning experiment
  • Positive controls to subclone a 15 kb fragment from a control BAC into the vector delivered with the kit
  • Detailed protocols, descriptions of plasmids, maps and sequences.

Sequences

ColE1-amp minimal vector

ampR
ColE1 ORI
GCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAAC GGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAA GCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTT ATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAA ATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAAC GCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTT TTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGT TGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAG AATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCT GACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGAT CATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATT AACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAG GCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTA TTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTA AGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACG CGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGAC CGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAG GGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGA TGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTG GAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTTGAACAACACTCAACC CTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTG GTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTA ACGTTTACAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACC AAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGA TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAAC AAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACT CTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTC TAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGT CTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACT GAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAG GCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGC TTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG ACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAAC GCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACA TGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGA GTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC GAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTA TTTCACACCGCATAGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGAC GCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGT



Red/ET Training Courses

Next course: date to be announced
Details

Download Red/ET Brochure

Red/ET Brochure Gene Bridges' Red/ET Recombination brochure provides a comprehensive introduction to the technology and an overview on Red/ET related products and services.

Japanese Version

Publications

References

 

 

 

Terms & Conditions | Disclaimer | Top of Page
© 2014 Gene Bridges GmbH