Gene Bridges 
 

Home | Company | Distributors | Contact

Back Back to list

FRT-PGK-gb2-neo-FRT

Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites

Manual [PDF]      Contact Support      Order      Sequences

Map

Description

The FRT-PGK-gb2-neo-FRT template is designed to allow neomycin/kanamycin selection in prokaryotic and eukaryotic cells. The FRT-PGK-gb2-neo-FRT template encodes the neomycin/kanamycin resistance gene which combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E.coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse Phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin/neomycin expression. The cassette is flanked by FRT sites for later excision by Flp-recombinase. Using the provided PCR template one can easily create a FRT-PGK-gb2-neo-FRT cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET Recombination step. The FRT-PGK-gb2-neo-FRT template is not linear but plasmid based (3446bp in size). Due to its R6K origin it can not replicate in most of the E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1ul per reaction as template.

Contents

  • FRT-PGK-gb2-neo-FRT: PCR template (50 ng/ul, 20ul)
  • Manual

Sequences

FRT-PGK-gb2-neo-FRT

FRT
Promoter
neoR
Terminator
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTA



Red/ET Training Courses

Next course: date to be announced
Details

Download Red/ET Brochure

Red/ET Brochure Gene Bridges' Red/ET Recombination brochure provides a comprehensive introduction to the technology and an overview on Red/ET related products and services.

Japanese Version

Publications

References

 

 

 

Terms & Conditions | Disclaimer | Top of Page
© 2014 Gene Bridges GmbH