Strain modifications examples:


Deletion of DE prophage from E. coli expression strain

Noll S, Reyelt J, Rysiok T, Kellner, R, Güssow D, Jäkel S, Hager S and Kranz H, 2013, Gezielte Optimierung von Escherichia coli BL21(DE3), Biospektrum, 19, 211

Using Red/ET recombination 89% of DE prophage sequence was removed from the genome of the E. coli expression strain BL21(DE3). The optimized strain T7E1 shows no phage activity while exhibiting consistent bacterial growth and heterologous protein expression pattern compared to the wildtype.


For more information and availability of E. coli T7E1 please contact us: contact@genebridges.com


pgl gene knock-in

Noll S, Reyelt J, Rysiok T, Kellner, R, Güssow D, Jäkel S, Hager S and Kranz H, 2013, Gezielte Optimierung von Escherichia coli BL21(DE3), Biospektrum, 19, 211

The pgl gene was successfully integrated into the chromosome of the pgl deficient E. coli expression strain (E. coli T7E1, please see above). The corresponding PGL enzyme catalyzes the hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate and thus prevents the accumulation of the electrophile substrate. A loss of the enzyme activity will result in random gluconoylation of cellular proteins including recombinant ones. The optimized strain T7E2 shows no gluconoylation of heterologous expressed protein at all, while in contrast the wildtype shows 6.4% undesired gluconoylation.

For more information and availability of T7E2 please contact us: contact@genebridges.com


Metabolic engineering by pathway modification

An efficient pathway engineering of E. coli was performed by several targeted gene knock-outs using Red/ET recombination. Overall five E. coli strains with up to seven knock-outs were generated. The most promising strain showed an improved succinate production of up to 47% in comparison to the wildtype (4%).

For more information please contact us: contact@genebridges.com


Metabolic engineering by promotor fine tuning

Braatsch S, Helmark S, Kranz H, Koebmann B and Jensen PR, 2008, Escherichia coli strains with promoter libraries constructed by Red/ET recombination pave the way for transcriptional fine-tuning, BioTechniques 45, 335

Red/ET recombination has been used for a promotor fine tuning in E. coli by replacing an entire promotor region or 5´elements with a synthetic promotor library (SPL).  SPL is based on randomized sequences flanking the consensus -10 and -35 promotor regions and allows fine-tuning of bacterial gene expression, overcoming the common all-or-nothing approach: change of gene expression by deletion and/or strong overexpression.

More precisely, the native promotor of the genomic localized phosphoglucose isomerase (pgi)-lacZ reporter construct was replaced by an SPL, and promotor sequences that resulted in activity range of 25% to 570% of the native pgi-promotor were rapidly identified in a blue white screening and a following beta-galactosidase activity test by Miller.

The combination of recombineering and SPL is applicable for optimizing gene expression in cell factories to remove bottlenecks or to reduce activities of metabolic pathways producing unwanted by-products.

SPL: N(5)TTGACAN(17)TATAATN(5)AAATCAGAAGAGTATTGCTAATG


For more information and availability please contact us: contact@genebridges.com

To the top

Please choose your country. If the country is missing, continue.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim