Features

  • No restriction sites necessary

  • Fragments up to 20 kb can be subcloned

  • High Red/ET efficiency

  • Convenient removal of the Red/ET recombination protein expression plasmid pRedET after recombination.

Applications

  • Basepair precise subcloning of DNA fragments from BACs into high a high-copy plasmid backbone

Description

Escherichia coli vectors that can contain large inserts, such as bacterial artificial chromosomes (BACs) offer several advantages for functional genomics. They can carry sufficient DNA to encompass most eukaryotic genes, including all cis-acting regulatory elements, as well as many eukaryotic gene clusters, prokaryotic regulons and many complete viral genomes, in a single molecule. However, conventional cloning methods rely on the use of restriction enzymes and in vitro purification steps, which preclude engineering of large molecules. Consequently, the usefulness of such molecules has been limited until recently.

The BAC subcloning kit is designed to subclone large DNA fragments of up to 20 kb efficiently from any type of bacterial artificial chromosomes  (BACs) into a plasmid vector by Red/ET recombination.

Red/ET recombination (recombineering) is the method that permits precise engineering of DNA molecules of any size, including very large ones such as BACs or the E. coli chromosome. It relies on homologous recombination in vivo in E. coli and allows a wide range of modifications with DNA molecules at any chosen position.

Contents

  • Red/ET recombination protein expression plasmid pRed/ET, any E. coli strain can be made Red/ET proficient by transformation with this plasmid

  • Linear vector carrying a ColE1 origin of replication plus ampicillin resistance gene to be used for the subcloning experiment

  • Positive controls to subclone a 15 kb fragment from a control BAC into the vector delivered with the kit

  • Detailed protocols, descriptions of plasmids, maps and sequences

Sequences

ColE1-amp minimal vector

ampR ColE1 ORI

GCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAAC GGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAA GCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTT ATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAA ATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAAC GCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTT TTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGT TGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAG AATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCT GACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGAT CATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATT AACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAG GCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTA TTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTA AGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACG CGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGAC CGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAG GGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGA TGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTG GAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTTGAACAACACTCAACC CTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTG GTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTA ACGTTTACAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACC AAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGA TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAAC AAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACT CTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTC TAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGT CTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACT GAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAG GCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGC TTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG ACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAAC GCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACA TGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGA GTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC GAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTA TTTCACACCGCATAGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGAC GCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGT


Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
  _  __   _    _               _____     ______  
 | |/ // | || | ||     ___    |  ___||  /_   _// 
 | ' //  | || | ||    /   ||  | ||__    `-| |,-  
 | . \\  | \\_/ ||   | [] ||  | ||__      | ||   
 |_|\_\\  \____//     \__ ||  |_____||    |_||   
 `-` --`   `---`       -|_||  `-----`     `-`'   
                        `-`                      
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, contact us at contact@genebridges.com.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim