Counter Selection BAC Modification Kit

€820.00*

Order now

Features

  • Fast BAC modification (2-3 weeks)

  • High Red/ET recombination efficiency

  • Convenient removal of the Red/ET plasmid

  • Efficiency much higher as with the pSacB-neo system

Applications

  • Fragment exchange

  • Marker insertion and deletion without leaving a selection marker or any unwanted sequences

  • Introduction of short sequences e.g. point mutations, loxP sites, restriction sites, etc.

  • Can also be used for bacterial chromosome modifications and common ColE1 origin plasmids

Description

This is a new version of counter-selection cassette pRpsL-neo based on Streptomycin selection. The kit is designed to modify any type of bacterial artificial chromosomes (BACs) within 2-3 weeks by using a counter-selection cassette. The included counter-selection cassette pRpsL-neo is based on Streptomycin selection which shows a much higher efficiency than pSacB-neo or comparable systems. This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids. This Kit combines the high Red/ET efficiency plus convenient removal of the Red/ET recombination protein expression plasmid pRedET after recombination.

Contents

  • Red/ET recombineering protein expression plasmid pRed/ET. Any E.coli strain can be made Red/ET proficient by transformation with this plasmid

  • BAC host E.coli strain DH10B already carrying the Red/ET plasmid

  • pRpsL-neomycin template to be used for your own experiments

  • Positive controls to introduce a point-mutation in a 150 kb BAC

  • Detailed protocols, descriptions of plasmids, maps and sequences

Sequences

rpsL-kanR/neoR selection cassette

promoter  rpsL  kanR/neoR

GGCCTGGTGATGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCG CCCTAAAATTCGGCGTCCTCATATTGTGTGAGGACGTTTTATTACGTGTTTACGA AGCAAAAGCTAAAACCAGGAGCTATTTAATGGCAACAGTTAACCAGCTGGTACGC AAACCACGTGCTCGCAAAGTTGCGAAAAGCAACGTGCCTGCGCTGGAAGCATGCC CGCAAAAACGTGGCGTATGTACTCGTGTATATACTACCACTCCTAAAAAACCGAA CTCCGCGCTGCGTAAAGTATGCCGTGTTCGTCTGACTAACGGTTTCGAAGTGACT TCCTACATCGGTGGTGAAGGTCACAACCTGCAGGAGCACTCCGTGATCCTGATCC GTGGCGGTCGTGTTAAAGACCTCCCGGGTGTTCGTTACCACACCGTACGTGGTGC GCTTGACTGCTCCGGCGTTAAAGACCGTAAGCAGGCTCGTTCCAAGTATGGCGTG AAGCGTCCTAAGGCTTAAGGAGGACAATCATGATTGAACAAGATGGATTGCACGC AGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAG ACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGG TTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGC AGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGG ATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGC AATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCG AAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGG ATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCT CAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGC TTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC GGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGC TGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCC GCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA



Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
            _____              __   __    _____   
  ____     |  ___||   ____     \ \\/ //  / ____|| 
 |    \\   | ||__    |    \\    \ ` //  / //---`' 
 | [] ||   | ||__    | [] ||     | ||   \ \\___   
 |  __//   |_____||  |  __//     |_||    \_____|| 
 |_|`-`    `-----`   |_|`-`      `-`'     `----`  
 `-`                 `-`                          
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, contact us at contact@genebridges.com.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim