Description

The iCreERT2-FRT-neo-FRT PCR template is designed to facilitate the insertion of such a functional cassette into targeting constructs by Red/ET recombination.

A codon-improved version of P1 bacteriophage derived Cre-recombinase is fused with the ligand-binding domain of the estrogen receptor (ER) to obtain a ligand-inducible recombinase. Mammalian codon usage was applied for the altered Cre version (iCre). By introducing silent base mutations the high CpG content of the prokaryotic coding sequence was reduced, thereby reducing the chances of epigenetic silencing in mammals.

The iCreERT2-FRT-neo-FRT template encodes the neomycin / kanamycin resistance gene (aminoglycoside phosphotransferase) which combines a prokaryotic promoter (gb2) for kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for neomycin resistance in mammalian cells.

The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglycerate kinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin/neomycin transcription. The cassette is flanked by FRT sites for later excision by Flp recombinase.

Using the provided PCR template one can easily create an iCre-FRT-neo-FRT cassette flanked by homology arms to insert the cassette by Red/ET recombination into the vector of choice. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The iCreERT2-FRT-neo-FRT template is not linear but plasmid based (4,185 bp in size). Due to its R6K origin it can’t replicate in most of the frequently used E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

Contents

  • iCreERT2-FRT-PGK-gb2-neo-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

iCreERT2-FRT-neo-FRT

iCreERT2  FRT  neoR  promoter

ATGGTCTCCAACCTGCTGACTGTGCACCAAAACCTGCCTGCCCTCCCTGTGGATG CCACCTCTGATGAAGTCAGGAAGAACCTGATGGACATGTTCAGGGACAGGCAGGC CTTCTCTGAACACACCTGGAAGATGCTCCTGTCTGTGTGCAGATCCTGGGCTGCC TGGTGCAAGCTGAACAACAGGAAATGGTTCCCTGCTGAACCTGAGGATGTGAGGG ACTACCTCCTGTACCTGCAAGCCAGAGGCCTGGCTGTGAAGACCATCCAACAGCA CCTGGGCCAGCTCAACATGCTGCACAGGAGATCTGGCCTGCCTCGCCCTTCTGAC TCCAATGCTGTGTCCCTGGTGATGAGGAGAATCAGAAAGGAGAATGTGGATGCTG GGGAGAGAGCCAAGCAGGCCCTGGCCTTTGAACGCACTGACTTTGACCAAGTCAG ATCCCTGATGGAGAACTCTGACAGATGCCAGGACATCAGGAACCTGGCCTTCCTG GGCATTGCCTACAACACCCTGCTGCGCATTGCCGAAATTGCCAGAATCAGAGTGA AGGACATCTCCCGCACCGATGGTGGGAGAATGCTGATCCACATTGGCAGGACCAA GACCCTGGTGTCCACAGCTGGTGTGGAGAAGGCCCTGTCCCTGGGGGTTACCAAG CTGGTGGAGAGATGGATCTCTGTGTCTGGTGTGGCTGATGACCCCAACAACTACC TGTTCTGCCGGGTCAGAAAGAATGGTGTGGCTGCCCCTTCTGCCACCTCCCAACT GTCCACCCGGGCCCTGGAAGGGATCTTTGAGGCCACCCACCGCCTGATCTATGGT GCCAAGGATGACTCTGGGCAGAGATACCTGGCCTGGTCTGGCCACTCTGCCAGAG TGGGTGCTGCCAGGGACATGGCCAGGGCTGGTGTGTCCATCCCTGAAATCATGCA GGCTGGTGGCTGGACCAATGTGAACATTGTGATGAACTACATCAGAAACCTGGAC TCTGAGACTGGGGCCATGGTGAGGCTGCTCGAGGATGGGGACCTCGAGCCATCTG CTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTC TAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTG TTGGATGCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCA GTGAAGCTTCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCA CATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGAT CAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCT GGCGCTCCATGGAGCACCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGA CAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGGAGATCTTCGACATGCTGCTG GCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCC TCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCT GAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGAC ACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGC GGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGG CATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTG CTGCTGGAGGCGGCGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGG CATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATC GCATTCCTTGCAAAAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACA GCTTGATGAAGATCTGAGCTCCCTGGCGGAATTCGGATCCAGATCTTATTAAAGC AGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAA TTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTC ATCAATGTATCTTATCATGTCTGGTCGATAATACGACTCACTATAGGGCTCGAGG AAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGCGCCGCACACAAAAACCAAC ACACAGATCATGAAAATAAAGCTCTTTTATTGGTACCGAATTCGCCAGGGAGCTC TCAGACGTCGCTTGGTCGGTCTTTATTCGAACCCCAGAGTCCCGCTCAGAAGAAC TCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGT AAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACG GGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCG ATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGC CATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAA CAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACA AGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGT CGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCAT GATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGC ACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAG CTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTG CAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCC TGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATCGTCTGTTGTGCCC AGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCC ATCTTGTTCAATGGCCGATCCCATGGTTTAGTTCCTCACCTTGTCGTATTATACT ATGCCGATATACTATGCCGATGATTAATTGTCAACACGTGCTGCTGCAGGTCGAA AGGCCCGGAGATGAGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCG TGCAGAATGCCGGGCCTCCGGAGGACCTTCGGGCGCCCGCCCCGCCCCTGAGCCC GCCCCTGAGCCCGCCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAGAAAGCG AAGGAGCAAAGCTGCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCT CAGCGGTGCTGTCCATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCA CGTCCTGCACGACGCGAGCTGCGGGGCGGGGGGGAACTTCCTGACTAGGGGAGGA GTGGAAGGTGGCGCGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCTACCGG TGGATGTGGAATGTGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAG CGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACC CGGTAGAATGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGCGGCGCCCTTT
AGTGAGGGTTAATT

 

Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
             ___     __   __    _____             
    ___     / _ \\   \ \\/ //  |  ___||     ___   
   /   ||  / //\ \\   \   //   | ||__      /   || 
  | [] || |  ___  ||  / . \\   | ||__     | [] || 
   \__ || |_||  |_|| /_//\_\\  |_____||    \__ || 
    -|_|| `-`   `-`  `-`  --`  `-----`      -|_|| 
     `-`                                     `-`  
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, continue.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim