Quick & Easy BAC Modification Kit

€695.00*

Order now

Features

  • Fast and reliable cloning of large DNA molecules

  • Precise DNA modification at position of choice

  • Independent of restriction sites

  • No size limitation

Applications

  • Simple BAC modification like insertion of a selection marker, deletion of a fragment with a selection marker gene, insertion of a function fragment together with selection marker gene

  • This kit can also be applied on bacterial chromosome modification

Description

This kit is designed to modify BACs with the revolutionary Red/ET recombination technology - a powerful tool for introducing modifications such as insertions and deletions into any type of BAC within 2 weeks.

Red/ET recombination uses in vivo recombination and proofreading activity to minimize unwanted mutations in your construct. Included in the kit are all the necessary contents for modifying BACs and all materials needed to perform a control experiment intended to familiarize you with this novel technique. Additionally, a vector converting any E. coli strain into competent strains for application with Red/ET recombination is provided. pSC101-BAD-gbaAtet comes with a tetracyclin resistance cassette. This cassette contains a temperature sensitive origin of replication (ori) that can only propagate at 30°C - at 37°C the plasmid will be lost. This allows for simple removal of the plasmid when it is no longer needed. To introduce a mutation (i.e. a selection cassette like the neomycin resistance cassette included with this kit) you first have to introduce homology sequences to the selection cassette. This can be done through a simple PCR reaction. These short homologous sequences (50 nt each) can be freely chosen for your experimental needs. Simply choose the location to be modified and insert the selection cassette directly at the desired nucleotide with the Red/ET recombination technology. The PCR product then needs to be electroporated in bacteria with the induced Red/ET recombination system. After successful Red/ET recombination the modified DNA can be recovered using conventional DNA mini-preparation methods.

Contents

  • pSC101-BAD-gbaA (tet) which is a derivative of pSC101 ori (a temperature sensitive origin) based Red/ET expression plasmid

  • BAC host carrying pSC101-BAD-gbaA (tet)

  • Positive control experiment for modifying a 150 kb BAC (BAC clone in the host carrying pSC101-BAD-gbaA, neo PCR product for deletion in BAC backbone, BAC-neo clone in the host as positive recombinant)

  • Protocols, descriptions of plasmids, maps and sequences of oligos

Sequences

Tn5-kanR/neoR selection cassette

Tn5-promoter  kanR/neoR

TGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGA AGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAG GGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAA GATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATG ACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGC GCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCG CAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGA AGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCC ATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCAT TCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGG TCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAA CTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCC ATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATT CATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCT ACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGC TTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGA
CGAGTTCTTCTGACTCGAG

 

Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
__    __    _____    _    _      ___     __   _   
\ \\ / //  |  ___|| | || | ||   / _ \\  | || | || 
 \ \/ //   | ||__   | || | ||  / //\ \\ | '--' || 
  \  //    | ||__   | \\_/ || |  ___  ||| .--. || 
   \//     |_____||  \____//  |_||  |_|||_|| |_|| 
    `      `-----`    `---`   `-`   `-` `-`  `-`  
                                                  
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, contact us at contact@genebridges.com.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim