Quick & Easy Conditional Knock Out Kit - FRT

€695.00*

Order now

Features

This kit is designed to integrate FRT sites in a vector plasmid at any intended position without the necessity to use restriction enzymes within 2-4 weeks

Applications

For fast and simple integration of FRT-sites into large vector plasmids at any intended position e.g. for generation of transgenic mouse models

Description

The included FRT-PGK-gb2-neo-FRT cassette is designed to allow neomycin / kanamycin selection in prokaryotic and eukaryotic cells. It combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E.coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The included pCI-FLPe expression plasmid is coding for an improved FLP recombinase which shows a four to tenfold higher recombinational activity compared to the wildtype FLP enzyme at temperatures between 37°C (optimal growth temperature for E.coli) and 40°C (mouse body temperature). This kit can also be used to work on bacterial artificial chromosomes. High Red/ET efficiency plus convenient removal of the Red/ET recombination protein expression plasmid pRedET after recombination.

Contents

  • Red/ET recombination protein expression plasmid pRed/ET. Any E. coli strain can be made Red/ET proficient by transformation with this plasmid

  • FRT-PGK-gb2-neo-FRT template to be used for your own experiments

  • Expression plasmid for enhanced FLP recombinase pCI-FLPe

  • Positive controls to introduce a FRT site in a 18 kb high copy plasmid

  • Detailed protocols, descriptions of plasmids, maps and sequences

Sequences

FRT-PGK-gb2-neo-FRT

FRT   promoter  neoR  terminator

AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTAT



Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
           __   __   _    _     _____    _    _   
  ____     \ \\/ // | \  / ||  |  ___|| | \  / || 
 |    \\    \ ` //  |  \/  ||  | ||__   |  \/  || 
 | [] ||     | ||   | .  . ||  | ||__   | .  . || 
 |  __//     |_||   |_|\/|_||  |_____|| |_|\/|_|| 
 |_|`-`      `-`'   `-`  `-`   `-----`  `-`  `-`  
 `-`                                              
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, contact us at contact@genebridges.com.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim