Quick & Easy E. coli Gene Deletion Kit

€695.00*

Order now

Features

  • Faithful recombineering by Red/ET

  • Fast and precise

  • Multiple knock-outs possible

  • Convenient removal of the recombineering plasmid

Applications

This kit is designed to knock-out or alter genes on the E.coli chromosome in less than one week.

Description

Red/ET recombination allows the exchange of genetic information in a base pair precise, specific, and faithful manner. An FRT-flanked kanamycin resistance marker cassette is supplied with the kit which can be used to replace a gene on the E. coli chromosome. Red/ET recombination can replace fragments as large as 30kb from the E. coli chromosome. The use of a FRT-flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP-recombinase step, if required. FLP expression plasmids can be purchased from Gene Bridges. Multiple knock-outs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges. The recombination process is strictly controlled due to an optimized design of the pRed/ET expression plasmid. The genes for the recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for a convenient removal of the plasmid after recombination.

Contents

  • Two Red/ET recombination protein expression plasmids pRed/ET (tet) and pRed/ET (amp). Any E. coli strain can be made Red/ET proficient by transformation with these plasmids

  • FRT flanked kanamycin resistance template (FRT-PGK-gb2-neo-FRT) to be used for your own experiments.

  • Positive controls to replace the gene for mannose transporter (manX) on the E. coli chromosome.

  • Detailed protocols, descriptions of plasmids, maps and sequences

Sequences

FRT-PGK-gb2-neo-FRT

FRT  promoter  neoR  terminator

AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTA



Distributors worldwide

Asia

China Shanghai QF Biosciences
India

Biotech Desk

or

AGILITY BIOTECH

Biotech Desk

Israel BioTag
Japan Funakoshi Funakoshi
Korea Mbiotech
Singapore
Malaysia
Thailand
Vietnam
iDNA
Taiwan Gendiscovery

Europe

Germany
Austria
Switzerland
BioCat BioCat
France Biovalley
Spain Quimigen
The Netherlands Brunschwig Chemie
United Kingdom
Ireland
Cambio
Denmark
Norway
Sweden
Finland
Estonia
Immuno Diagnostic
Estonia
Latvia
Lithuania
Nanodiagnostika

North America

USA AS ONE International, INC. AS ONE INTERNATIONAL, INC.

South America

Chile Valquim

Troubleshooting

Should you have any problems using Red/ET technology, please consult our Troubleshooting Guide first.

Please complete all required fields marked with a asterix (*).

 
 ______    _    _    ______     ______   _    _   
|      \\ | || | || |      \\  /_   _// | || | || 
|  --  // | || | || |  --  //   -| ||-  | || | || 
|  --  \\ | \\_/ || |  --  \\   _| ||_  | \\_/ || 
|______//  \____//  |______//  /_____//  \____//  
`------`    `---`   `------`   `-----`    `---`   
                                                  
 

How to contact our support

Should you have any further questions, please contact us directly.

Gene Bridges GmbH

Im Neuenheimer Feld 584

69120 Heidelberg

Germany

P +49 6221 13708 11

F +49 6221 13708 29

Technical inquiries:

contact@genebridges.com

Commercial licensing:

licenses@genebridges.com

* Prices may vary. Please check our list of distributors. Shipping charges are 45.00 EUR for Europe, 120.00 EUR for Overseas, unless you provide us with your forwarder's customer account number. Potential import duties and customs clearance costs will be charges directly to the customer.

To the top

Please choose your country. If the country is missing, contact us at contact@genebridges.com.

Shanghai QF Biosciences
Shanghai QF Biosciences
NeuProCell
Biotech Desk
NeuProCell
Biotech Desk
BioTag
BioTag
Funakoshi
Funakoshi
Mbiotech
Mbiotech
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
iDNA
Gendiscovery
Gendiscovery
BioCat
BioCat
BioCat
BioCat
BioCat
BioCat
Biovalley
Biovalley
Quimigen
Quimigen
Brunschwig Chemie
Brunschwig Chemie
Cambio
Cambio
Cambio
Cambio
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Immuno Diagnostic
Nanodiagnostika
Immuno Diagnostic
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
Nanodiagnostika
AS ONE INTERNATIONAL, INC.
AS ONE INTERNATIONAL, INC.
Valquim
Valquim